Comparison of four phaC genes from Haloferax mediterranei and their function in different PHBV copolymer biosyntheses in Haloarcula hispanica

Identification and analysis of the phaC genes in Hfx. mediterranei

Hfx. mediterranei is comprised of one chromosome and three extrachromosomal elements (megaplasmids) [24]. The genome sequence of Hfx. mediterranei CGMCC 1.2087 has been recently completed by our group. The genes encoding its PHA synthase, named phaE_Hme and phaC_Hme, have already been cloned and characterized [6] and were found to be located on megaplasmid pHM300. Interestingly, analysis of the whole genome sequence revealed that three other phaC paralogs existed in this strain and were designated phaC1, phaC2, and phaC3.

The phaC1 was mapped to the chromosome, whereas phaC2 and phaC3 were both mapped to megaplasmid pHM500 (Figure 1). Most of the genes adjacent to the four phaCs encoded conserved hypothetical proteins with unknown functions (Figure 1). The four PhaC proteins of Hfx. mediterranei exhibited homology to each other (43%-58% identity), and they all contained the catalytic triad residues (Cys-Asp-His) (Figure 2). Both the "Lipase box-like" sequence (Gly-X-Cys-X-Gly-Gly) and the conserved motif of type III PHA synthase were present in PhaC_Hme, PhaC1, and PhaC3 (Figure 2). In the case of PhaC2, the last "Gly" residue of the "Lipase box-like" sequence was replaced by an "Ala", and the conserved motif of the type III PHA synthase was also not strongly conserved (Figure 2). The deduced molecular weights of the four PhaCs were as follows: PhaC_Hme-54.8 kDa, PhaC1-49.7 kDa, PhaC2-40.4 kDa, and PhaC3-62.5 kDa. Only the molecular weight of PhaC_Hme was equivalent to that of the PhaCs from Haloarcula marismortui (53.1 kDa; Accession no., YP_137339), Haloarcula hispanica (53.0 kDa; Accession no., ABV71394), and Haloquadratum walsbyi (52.1 kDa, Accession no., YP_658052). When compared with the primary sequences of the other three PhaCs, the C terminal sequence was missing in PhaC2, which resulted in the smallest molecular weight.

Only phaC _Hme was transcribed in Hfx. mediterraneiin laboratory conditions

In previous work, we found that the phaEC_Hme-deleted strain Hfx. mediterranei PHBV-1 could not accumulate detectable scl-PHAs and expression of phaE_Hme alone could not restore the ability to accumulate scl-PHAs [6], which indicated that there were no additional functional PhaC subunits in Hfx. mediterranei PHBV-1. To provide some clues to this phenomenon, RT-PCR with gene-specific primer pairs for the four phaC genes (Table 1) was employed to determine whether they were transcribed in the wild-type strain. The lengths of the PCR products of phaC_Hme, phaC1, phaC2, and phaC3 were 382 bp, 391 bp, 408 bp, and 412 bp, respectively. The results demonstrated that of the four genes, only phaC_Hme was actively transcribed in MG medium (Figure 3A), which was consistent with our previous observation that PhaC_Hme was indispensable for PHBV biosynthesis in Hfx. mediterranei, as the other three phaCs were not expressed.

Plasmids or primers	Relevant characteristics	Sources or references
Plasmids
pWL3E	11.2-kb, phaEHme and its native promoter	[6]
pWL3EC	12.6-kb, phaECHme and its native promoter	[6]
pWL3EC1	12.5-kb, derivative of pWL3E, phaC1 insert	This study
pWL3EC2	12.2-kb, derivative of pWL3E, phaC2 insert	This study
pWL3EC3	12.9-kb, derivative of pWL3E, phaC3 insert	This study
Primers for RT-PCR (5'-3' sequence)
phaC-RT-F	GTACATTCTCGACCTCCA
phaC-RT-R	AGGAACGTTTCCAAACGC
phaC1-RT-F	ATGACCATGAACCCGTTT
phaC1-RT-R	CGATGTACCGATTCACGT
phaC2-RT-F	ATGTTCCCTAACCTCGTC
phaC2-RT-R	GTCCGCCTCAGTTCGTTC
phaC3-RT-F	ATGACAGATGATGGGCGT
phaC3-RT-R	CGATGTAGCGATTGACGT
Primers for expression (5'-3' sequence a )
phaC1-BamHI-F	ATAGGATCCATGACCATGAACCCGTTT
phaC1-KpnI-R	AGCGGTACCTTAGCTGGTGCGTTGTCT
phaC2-BamHI-F	ATAGGATCCATGTTCCCTAACCTCGTC
phaC2-KpnI-R	AGCGGTACCTTATCCGTTTGGTGACGC
phaC3-BamHI-F	ATAGGATCCATGACAGATGATGGGCGT
phaC3-KpnI-R	AGCGGTACCTCAGTCATCTTCTGTACC

^aSequences representing the restriction sites are underlined.

Genetic analysis of the functions of the four PhaCs in Haloarcula

To determine if phaC1, phaC2, and phaC3 could encode functional proteins, a PHA synthase gene-deleted strain, named Har. hispanica PHB-1 [13], was used to heterologously express these proteins. Because PhaC proteins were proposed to be functional combined with the PhaE subunit, the three expression plasmids designated pWL3EC1, pWL3EC2, and pWL3EC3 (Table 1) were constructed based on the PhaE_Hme-expression plasmid pWL3E [6] and individually introduced into Har. hispanica PHB-1. During fermentation, Har. hispanica PHB-1/pWL3E [6] and the wild-type strain were used as the negative and positive control, respectively. To compare the PHBV synthesized by the four PHA synthases with distinct PhaC subunits, Har. hispanica PHB-1/pWL3EC [6] harboring the phaEC_Hme genes of Hfx. mediterranei was also employed.

Properties of PHBV synthesized by different PhaC subunits

DSC analysis showed that the glass-transition temperatures (T_g) of the PHBV samples were 2.3°C (PhaEC_Hme-PHBV), -0.1°C (PhaEC1-PHBV), and 5.7°C (PhaEC3-PHBV). This result was consistent with the 3HV monomer composition of the three types of PHBV; a larger amount of 3HV incorporated into PHBV could lead to lower T_g. A similar melting temperature (T_m) was observed for all three PHBV samples, of which the PHBV with the lowest T_m synthesized by PhaEC1 could facilitate its processing ability. Compared with the other two polymers, no cold crystallization temperature (T_c) was detected for the PHBV accumulated by PhaEC3. This result demonstrated that this polymer (with a high 3HB fraction) possessed a fast crystallization speed, which could also provide some advantages in processing.

Thermal stability plays an important role in polymer melt processing. This characteristic of the three types of PHBV was determined by TGA (Table 3 and Figure 4). The temperature at 5% weight loss (T_d) was used to evaluate their polymer thermal stability. The T_d of the three polymers ranged from 252°C to 257°C. Our results showed that the three types of PHBV, with different monomer composition, changed obviously in their thermal properties.

Strains, plasmids, and growth conditions

The plasmids used in this study were listed in Table 1. All of the plasmids were derivatives of pWL3E [6]. These plasmids were first constructed in Escherichia coli JM109 and then introduced into Har. hispanica PHB-1, a phaEC-deleted strain [13], using the polyethylene glycol-mediated transformation method [26].

E. coli JM109 was cultivated in Luria-Bertani (LB) medium at 37°C [27]. When needed, ampicillin (100 mg/l) was added to the medium. Har. hispanica and Hfx. mediterranei were grown in AS-168 medium. For growth on plates, the media described above were supplemented with 1.2% (w/v) agar. For PHA accumulation, the haloarchaeal strains were transferred from AS-168 medium to MG medium and cultivated as previously described [6]. When required, mevinolin was added to a final concentration of 5 mg/l for H. hispanica recombinants. All of the strains were cultured at 37°C.

Primers and plasmid construction

All of the primers used in this study were summarized in Table 1. To determine the capabilities of PhaC1, PhaC2, and PhaC3 to synthesize PHAs, three expression plasmids were constructed. The expression vectors were derived from pWL3E, which contained the phaE_Hme gene of Hfx. mediterranei with its native promoter [6]. The coding sequences of phaC1, phaC2, and phaC3 were amplified from Hfx. mediterranei by PCR with primer pairs phaC1-BamHI-F/phaC1-KpnI-R, phaC2-BamHI-F/phaC2-KpnI-R, and phaC3-BamHI-F/phaC3-KpnI-R, respectively. The purified PCR products (phaC1, 1.3 kb; phaC2, 1.1 kb; phaC3, 1.7 kb) were digested with BamHI and KpnI and inserted into BamHI and KpnI-treated pWL3E. The resulting expression plasmids pWL3EC1, pWL3EC2, and pWL3EC3 were confirmed by DNA sequencing and individually introduced into Har. hispanica PHB-1. The haloarchaeal recombinants harboring pWL3EC [6], pWL3EC1, pWL3EC2, and pWL3EC3 were subjected to PHA accumulation analysis in which Har. hispanica PHB-1 harboring pWL3E and the wild-type strain were used as the negative and positive control, respectively.

Isolation of total RNA and reverse transcription PCR (RT-PCR)

Total RNA of Hfx. mediterranei was extracted using TRIzol reagent (Invitrogen) from a logarithmic-phase culture grown in MG medium. Four specific primer pairs, phaC-RT-F/phaC-RT-F, phaC1-RT-F/phaC1-RT-F, phaC2-RT-F/phaC2-RT-F, and phaC3-RT-F/phaC3-RT-F, were designed for the phaC_Hme, phaC1, phaC2, and phaC3 genes, respectively (Table 1). Prior to RT-PCR, the specificity of these primers were confirmed by sequencing of the corresponding PCR products using the genomic DNA of Hfx. mediterranei as template. For RT-PCR, the RNA sample was digested with RNase-free RQ1 DNase (Promega) overnight to eliminate any DNA contamination, which was subsequently confirmed by a control PCR without prior reverse transcription as previously described [28]. The DNA-free RNA sample was then used as the template for RT-PCR using the OneStep RT-PCR Kit (Qiagen) according to the manufacturer's instruction. The PCR products were electrophoresed in a 1% agarose gel.

Measurement of PHA content and composition

Scl-PHAs were qualitatively and quantitatively analyzed by gas chromatography (GC) with the Agilent GC-6820 as described previously [6, 13]. Benzonic acid was used as an internal standard to calculate the amount of PHAs. PHBV (Sigma) was used as the standard for peak identification. The average results of three parallel experiments were recorded.

Extraction and purification of PHAs

After fermentation, the liquid cultures were harvested by centrifugation at 9000 rpm for 10 min. The cell pellets were resuspended in distilled water containing 0.1% SDS (w/v) and agitated for 20 min. The suspension was centrifuged at 5000 rpm for 5 min and yielded whitish, compact sediment. The sediment was resuspended and washed twice with 0.1% SDS solution (w/v) and distilled water, respectively. The resulting paste was dried in an oven at 70°C for 2 h for further purification. The extracted PHAs were treated with hot chloroform at 90°C for 4 h, followed by precipitation with 15 volume of pre-chilled ethanol. To obtain pure product, the precipitate was then redissolved in chloroform and the process was repeated. The collected PHAs were dried at 40°C for 24 h to remove all residual solvent.

Molecular weight determination of PHBV

The molecular weight of PHBV was estimated via gel permeation chromatography (GPC) with a Waters 1515 system at 30°C using a Waters 1525 pump equipped with a four Styragel column series (Styragel HR, 5 μm). A differential refractive index detector and a UV detector were both employed. Chloroform was used as the elution solvent at a flow rate of 1.0 ml/min. The concentration of the samples was 2 mg/ml and the injection volume was 50 μl. The calibration curve was generated with polystyrene standards (Sigma).

Characterization of PHBV thermal properties

Differential scanning calorimetry (DSC) was performed using a TA Instruments Q100 with an autocool accessory calibrated with indium to characterize thermal transitions of the polymers. The following protocol was used for each sample. A 3-5 mg sample in an aluminum pan was cooled from room temperature to -60°C by the autocool accessory. The pan was heated from -60°C to 180°C at a rate of 10°C/min, isothermally maintained at 180°C for 5 min, quenched to -60°C, and reheated from -60°C to 180°C at 10°C/min under a nitrogen flow rate of 50 ml/min. Data were collected during the second heating run.

Thermal stability of the PHA polymer was determined via thermogravimetric analysis using a Q50 thermogravimetric analyzer (TGA) (TA Instruments). The procedures used were as the same as those described by Xie et al. [29]. Briefly, samples were analyzed at a heating rate of 10°C/min under a nitrogen atmosphere with a N2 flow rate of 60 ml/min.

Phylogenetic tree construction

The phylogenetic tree for PhaC was constructed using the neighbor-joining method [30] with Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0 [31]. The topology of the phylogenetic tree was evaluated by bootstrap analysis on the basis of 1000 replications [32].

Nucleotide and protein sequence analysis

Sequences of the PhaC proteins from Hfx. mediterranei were deposited in GenBank under the accession numbers phaC_Hme-EU374220, phaC1-HM116246, phaC2-HM116247, and phaC3-HM116248. These PhaC sequences were analyzed using the GeneDoc program (http://www.nrbsc.org/gfx/genedoc/index.html).