Skip to main content

Table 1 Oligonucleotides used in this study

From: Variation in spatial and temporal incidence of the crustacean pathogen Hematodinium perezi in environmental samples from Atlantic Coastal Bays

Oligo-nucleotide Sequence (5′ to 3′) Purpose/target Source
PlaceF GGGTAATCTTCTGAAAACGCATCGT Hematodinium SSU [29]
PlaceR GTACAAAGGGCAGGGACGTAATC Hematodinium SSU [29]
D2C CCTTGGTCCGTGTTTCAAG Dinoflagellate LSU [33]
1487 F CCTGGCTCGATAGAGTTG Hematodinium SSU [28]
HemITSF2 TCGTAACAAGGTTTCCGTAGG Hematodinium SSU This study
HemITSR2 GACCCAGCCTTCACGATAAA Hematodinium LSU This study
M13 F CGCCAGGGTTTTCCCAGTCACGAC pGEM-T vector  
M13 R TCACACAGGAAACAGCTATGAC pGEM-T vector  
ITS2For AGGTCTAATGCTTGTTGGCC H. perezi ITS2 qPCR This study
ITS2Rev CACTAGTCCGAAAACCTGTG H. perezi ITS2 qPCR This study
HemITS2 probe 6-FAM-ACCGCTACTCTTCTT-CCGCCCT-BHQ1 H. perezi ITS2 qPCR This study