Skip to main content

Advertisement

Table 1 Primers used for PCR amplification of prolactin genes

From: Gene encoding prolactin in cinnamon clownfish Amphiprion melanopus and its expression upon acclimation to low salinities

Primers Sequences (5′→3′)
Deg-F CCCTCCATGTGCCACACCTCC
Deg-R AGGACTTTCAGGAAGCTGTCAAT
DW-F1 GAGCTGCAGGAGCACTCCAAGAC
DW-F2 CTCGGCCAGGACAAGATCTCCAA
DW-F3 TTCCTGCTGTCCTGCTTTCGCCG
DW-R1 GTCTTGGAGTGCTCCTGCAGCTC
DW-R2 TGACACTTGCAGAGCTTGTTCCTTGTC
DW-R3 CTTGTCATTGGGCGTCTGCAGAG
DW-R4 CTGATGGGAACAGCTTTACACGCTGC
PRLF ATGGCTCAGAGAAGAACCAATGGAAGC
PRLR TTAGCACATCTCAGGCTGCATCTTTGC
  1. Deg: degenerate primer; DW: DNA walking; F: forward; PRL: prolactin; R: reverse.