Skip to main content

Advertisement

Table 1 Primer sequences for cloning of the full-length cDNA of C. sapidus aquaporin-1 ( CasAQP-1 ) and qRT-PCR assays

From: Cloning of aquaporin-1 of the blue crab, Callinectes sapidus: its expression during the larval development in hyposalinity

  Primer sequence (5′ to 3′)
CasAQPdF1 GGNCAYATHWSKGGHGSHCA
CasAQPdF2 CAYATHAAYCCNGCNGTNAC
CasAQPdR1 GGNCCNAYCCARWANAYCCA
CasAQPdR2 AAMSWNCKRGCDGGRTTCAT
CasAQP-1-3F1 CTGGTCGCCCGCTACGTGT
CasAQP-1-3F2 CCCTGCTCTACATCATGGCCCAGTG
CasAQP-1-5R1 CCTGTCCCTTTGACATCGTT
CasAQP-1-5R2 CCGAACACCGTCAGCACGAGAATGA
CasAQP-1-QF CTCACGCCACAGGAAAAGCAAG
CasAQP-1-QR CAGCACGAGAATGAAGGTAATGAGG
  1. ‘d’ = degenerate primer; QF- and –R primers for qRT-PCR assay.