Skip to main content

Table 7 Primers used in this study

From: Molecular (PCR-DGGE) versus morphological approach: analysis of taxonomic composition of potentially toxic cyanobacteria in freshwater lakes

Primer Sequence (5′ to 3′) Melting temperatures (°C) Reference
mcy A    
(GC)mcyA-Cd1F AAAATTAAAAGCCGTATCAAA 42.6 (84.1 with CG clamp) [8, 28]