Skip to main content

Advertisement

Table 7 Primers used in this study

From: Molecular (PCR-DGGE) versus morphological approach: analysis of taxonomic composition of potentially toxic cyanobacteria in freshwater lakes

Primer Sequence (5′ to 3′) Melting temperatures (°C) Reference
ITS    
(GC)CSIF G(T/C)CACGCCCGAAGTC(G/A)TTAC 53.8-57.9 [7]
373R CTAACCACCTGAGCTAAT 45.8 [7, 27]
mcy A    
(GC)mcyA-Cd1F AAAATTAAAAGCCGTATCAAA 42.6 (84.1 with CG clamp) [8, 28]
mcyA-Cd1R AAAAGTGTTTTATTAGCGGCTCAT 50.6 [8, 28]
  1. (GC) indicates 5′-CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC-3′.