Skip to main content

Table 5 Primers and Taqman probes used for q-PCR

From: Transcriptional responses to biologically relevant doses of UV-B radiation in the model archaeon, Halobacteriumsp. NRC-1

Primer name

Sequence 5'-3'

Size (bp)

Accession numbers

RadA1-rtF

ACACCCTCACGGAGCTCGT

77

GI:10581871

RadA1-rtR

CATCTGGTGGTTGGAGTTGAAG

  

RadA1-probe

6-FAM-TCCTGGACAAGATCCACGTCGCG-BHQ1

  

Vng17-rtF

TGTCACGGTGATTGGTTTCG

92

GI:10579665

Vng17-rtR

AAGTCTGCAGAGTTTCTGCATCG

  

Vng17-probe

6-FAM-CACGACCTCGGCACGTGGCTAGT-BHQ1

  

Vng280-rtF

CAGAATGGCGTCCTCGTCGT

128

GI:10579913

Vng280-rtR

GGACGCAGTTCGAACTCCTCTC

  

Vng280-probe

6-FAM-TACGCGCCCACCGTGCTGACCG-BHQ1

  

Top6B-rtF

TCCACGACTACATCAAACACACG

89

GI:10580449

Top6B-rtR

GCGCTCTGATTTGAGCTCG

  

Top6B-probe

6-FAM-TCGTGAACCCACACGCCCGCAT-BHQ1

  

Vng0779-rtF

ATGAGCGAGGCCCTCGATTAC

80

GI:10580354

Vng0779-rtR

ACGTTCAGGATGTCCGCGAT

  

Vng0779-probe

6-FAM-TACATGCTCCGGTACGACCACGGCA-BHQ1

  

Dbp-rtF

GCCACCTCTCGCTGGTCG

108

GI:10581584

Dbp-rtR

CGAGCGTGTCGTAGAGGTCG

  

Dbp-probe

6-FAM-TACACGTCTGCGCAGCTCGCTGC-BHQ1

  

Eef2-rtF

ACGAAAGAAGATTGTCGAACAGTG

110

GI:10582035

Eef2-rtR

TGTCAGTGAGGGTGGTTTTTCC

  

Eef2-probe

JOE-AACGGCTGATGGACAACCCGGAGC-BHQ1