Skip to main content

Table 5 Primers and Taqman probes used for q-PCR

From: Transcriptional responses to biologically relevant doses of UV-B radiation in the model archaeon, Halobacteriumsp. NRC-1

Primer name Sequence 5'-3' Size (bp) Accession numbers
RadA1-rtF ACACCCTCACGGAGCTCGT 77 GI:10581871
RadA1-rtR CATCTGGTGGTTGGAGTTGAAG   
RadA1-probe 6-FAM-TCCTGGACAAGATCCACGTCGCG-BHQ1   
Vng17-rtF TGTCACGGTGATTGGTTTCG 92 GI:10579665
Vng17-rtR AAGTCTGCAGAGTTTCTGCATCG   
Vng17-probe 6-FAM-CACGACCTCGGCACGTGGCTAGT-BHQ1   
Vng280-rtF CAGAATGGCGTCCTCGTCGT 128 GI:10579913
Vng280-rtR GGACGCAGTTCGAACTCCTCTC   
Vng280-probe 6-FAM-TACGCGCCCACCGTGCTGACCG-BHQ1   
Top6B-rtF TCCACGACTACATCAAACACACG 89 GI:10580449
Top6B-rtR GCGCTCTGATTTGAGCTCG   
Top6B-probe 6-FAM-TCGTGAACCCACACGCCCGCAT-BHQ1   
Vng0779-rtF ATGAGCGAGGCCCTCGATTAC 80 GI:10580354
Vng0779-rtR ACGTTCAGGATGTCCGCGAT   
Vng0779-probe 6-FAM-TACATGCTCCGGTACGACCACGGCA-BHQ1   
Dbp-rtF GCCACCTCTCGCTGGTCG 108 GI:10581584
Dbp-rtR CGAGCGTGTCGTAGAGGTCG   
Dbp-probe 6-FAM-TACACGTCTGCGCAGCTCGCTGC-BHQ1   
Eef2-rtF ACGAAAGAAGATTGTCGAACAGTG 110 GI:10582035
Eef2-rtR TGTCAGTGAGGGTGGTTTTTCC   
Eef2-probe JOE-AACGGCTGATGGACAACCCGGAGC-BHQ1